Upload data for probe searches

When you do certain probe searches, you can upload files that contain entries for specific probe search criteria. For example, in a Standard HD-CGH Genomic Intervals Search, you can upload a file of the desired genomic intervals. This feature is especially useful if you have many items to enter, or need to do several related searches that use the same list of items. The information in this topic also applies when you want to upload a file of search parameters for bait searches in the SureSelect Target Enrichment and SureSelect RNA Enrichment application types.

This help topic contains the following sections:

File formats

Information for specific search parameters appears below.

Example:
chr1:1-1000000         500     Yes     Yes
chr2:500-5000000       1000    Yes     No

chr2:5000000-8000000   1000    Yes     Yes

chr1:1-500001 (Chromosome 1, base pairs 1 to 500001)
chr1 (all of chromosome 1)
chrX:2000500 (X chromosome from 2000500 to the end)

Example:
H3N1
CTSB
BRCA1
 

MIMAT0000068
MIMAT0000069

A_14_P100053
A_14_P100055
A_14_P100056
A_14_P100057
A_14_P100059
A_14_P100227

ACGTAGCTAGAGCTAGCTGAGCTGAGCTGAGATCGATGCTAGTGATCGAT
ATTATGGATGATTGATGAGTAGTAGAGAGGCGCGCTAGCATCGCTAGCTA

ACGTACGATAGCGCGCAGCTAATGATGACGCAGATCAGAGACGATCGCGA

CCTACCGATGTCTGCTACAGACGGCGGGGATGACGATACGATACGGCGTG

rs7172939
rs6549950
rs4490399

 

Upload a data file for a probe search

If other instructions do not appear in the specific help topic, follow these steps to upload the file.

  1. Next to the desired search criterion, click Upload (or the similarly-named button that appears there).

    A file name window appears.

  1. Click Browse.

    A Choose File dialog box appears.

  2. Select the desired file, then click Open.

    The name of the file appears in File Name.

  3. Click Upload File.

    eArray uploads the file, and the entries from the file appear in pipe-separated format in the appropriate box on the search page.

 

Examples

Example 1 – Probe Sequences

To create a text file that contains multiple probe sequences for the Probe Sequence search criterion in Search Your Probes, do the following:

  1. Open a text editor such as Notepad.

  2. Type the first probe sequence, for example:

    CCTACTTGACCGGAATGAATCCAATGCTCGGAGCAATGAATGCGGCTCATCAGCACGCGT

  3. Press ENTER.
    The
    insertion point moves to the beginning of a new line.

  4. Type the second probe sequence, for example:

    AAATCCAAATGTTATTTATGGACAAACACCAAGGATAACGCCCTATGAGA

  5. Press ENTER. Continue to add more probe sequences, as desired.

  6. Save the text file.

    Give the file an extension of .txt

    When you upload this file to eArray from the Search Your Probes page, all of the probe sequences appear in pipe-separated format in the search term box in Search Type.
     

Example 2 – Accessions

To create a text file that contains multiple accession values for the Accessions search criterion for Search Your Probes, follow these steps:

  1. Open a text editor such as Notepad.

  2. Type the first accession value, for example Q0055

  3. Press Enter.

    The
    insertion point moves to the beginning of a new line.

  4. Type the second accession value, for example Q0061

  5. Press Enter, then add more accession values, as desired.

  6. Save the text file.

    Give the file an extension of .txt

    When you upload this file to eArray from the Search Your Probes page, all of the Accession values appear in pipe-separated format in the search term box in Search Type.

See also

Search Your Probes

How to do a High Density (HD) Search

Search for Baits

How to use Interval Finder

Find exon intervals