Upload file for probe searches

When you do certain probe searches, you can upload files that contain entries for specific probe search criteria. For example, in a Standard HD-CGH Genomic Intervals Search, you can upload a file of the desired genomic intervals. This feature is especially useful if you have many items to enter, or need to do several related searches that use the same list of items. The information in this topic also applies when you want to upload a file of search parameters for bait searches in the SureSelect Target Enrichment and SureSelect RNA Enrichment application types.

This help topic contains the following sections:

File formats
Upload a data file for a probe search
Examples

File formats

Information for specific search parameters appears below.

Accessions – For Search Standard Probes, Search Your Baits, Exon Probe Search, Interval Finder, and Exon Interval Finder

Put one accession on each line. Enter accession values without sources, as the sources are already provided by eArray. So sgd|Q0055 will be only Q0055.

Advanced Search Interval – For Advanced Genomic Interval HD Search

Put one interval on each line. You can include column headings as the first line of the file, but eArray does not interpret them. Each line must contain the following entries, separated by tabs, in this order:

Genomic Interval – A cytoband (for example, 1p36.33) or a chromosomal location, for example:
chr1:1-500001
chr1 (all of chromosome 1)
chrX:2000500 (X chromosome from 2000500 to the end)

For a given search, all the intervals must be of the same type (for example, all chromosomal locations or all cytobands).
Average Spacing – Average number of base pairs between each of the retrieved probes within the interval.

Guidance from Agilent on probe density for CGH microarrays
TM Filtered – Yes or No. For this interval, removes probes with TMs that lead to poor performance on the Agilent platform.
HM Filtered – Yes or No. Removes probes that bind to more than one location on the genome. (Homology filtering)

Example:
chr1:1-1000000         500     Yes     Yes
chr2:500-5000000       1000    Yes     No
chr2:5000000-8000000   1000    Yes     Yes

Bait ID – For Search Your Baits

Put one bait ID on each line

Bait Sequence – For Search Your Baits

Put one sequence on each line. Use only the capital characters A, C, G, and T. The length of the bait sequences must match the value you select in Length.

Chromosomal Location – For Search Standard Probes, Search Your Baits, and Exon Probe Search

Put one chromosomal location on each line. Use the format illustrated in the following examples.

chr1:1-500001 (Chromosome 1, base pairs 1 to 500001)
chr1 (all of chromosome 1)
chrX:2000500 (X chromosome from 2000500 to the end)

Cytoband — For Search Standard Probes, Search Your Baits, Exon Probe Search, Interval Finder, and Exon Interval Finder

Put one cytoband on each line.

Exclusion Intervals – For SNP searches by genomic interval, and HD searches

Put one interval on each line.

Gene Annotations – For HD-CGH Gene Annotations Search

Put one annotation on each line. Annotations can be either accession numbers (for example, NM_016660 or AY884282) or gene symbols (for example, H3N2 or CTSB), but for a given search the annotations must all be of the same type.

GeneSymbol – For Search Standard Probes, Search Your Baits, Interval Finder, and Exon Interval Finder

Put one gene symbol on each line. Use capital (upper case) letters in gene symbols

Example:
H3N1
CTSB
BRCA1

microRNA name – For microRNA Search Standard Probes

Put one microRNA name on each line.

miMAT# – For microRNA Search Standard Probes

Put one miMAT# on each line. For example:

MIMAT0000068
MIMAT0000069

Probe ID – For Search Standard Probes, HD Probe ID Search, Exon Probe Search, and SNP probe searches by probe ID

Put one probe ID on each line. For example:

A_14_P100053
A_14_P100055
A_14_P100056
A_14_P100057
A_14_P100059
A_14_P100227

Probe Sequence – For Search Standard Probes and Exon Probe Search

Put one sequence on each line. For example:

ACGTAGCTAGAGCTAGCTGAGCTGAGCTGAGATCGATGCTAGTGATCGAT
ATTATGGATGATTGATGAGTAGTAGAGAGGCGCGCTAGCATCGCTAGCTA
ACGTACGATAGCGCGCAGCTAATGATGACGCAGATCAGAGACGATCGCGA
CCTACCGATGTCTGCTACAGACGGCGGGGATGACGATACGATACGGCGTG

SNP ID – For SNP probe searches by SNP ID

Put one SNP ID on each line. For example:

rs7172939
rs6549950
rs4490399

Upload a data file for a probe search

If other instructions do not appear in the specific help topic, follow these steps to upload the file.

Next to the desired search criterion, click Upload (or the similarly-named button that appears there).

A file name window appears.

Click Browse.

A Choose File dialog box appears.
Select the desired file, then click Open.

The name of the file appears in File Name.
Click Upload File.

eArray uploads the file, and the entries from the file appear in pipe-separated format in the appropriate box on the search page.

Examples

Example 1 – Probe Sequences

To create a text file that contains multiple probe sequences for the Probe Sequence search criterion in Search Standard Probes, do the following:

Open a text editor such as Notepad.
Type the first probe sequence, for example:

CCTACTTGACCGGAATGAATCCAATGCTCGGAGCAATGAATGCGGCTCATCAGCACGCGT
Press ENTER.
The insertion point moves to the beginning of a new line.
Type the second probe sequence, for example:

AAATCCAAATGTTATTTATGGACAAACACCAAGGATAACGCCCTATGAGA
Press ENTER. Continue to add more probe sequences, as desired.
Save the text file.

Give the file an extension of .txt

When you upload this file to eArray from the Search Standard Probes page, all of the probe sequences appear in pipe-separated format in the search term box in Search Type.

Example 2 – Accessions

To create a text file that contains multiple accession values for the Accessions search criterion for Search Standard Probes, follow these steps:

Open a text editor such as Notepad.
Type the first accession value, for example Q0055
Press Enter.

The insertion point moves to the beginning of a new line.
Type the second accession value, for example Q0061
Press Enter, then add more accession values, as desired.
Save the text file.

Give the file an extension of .txt

When you upload this file to eArray from the Search Standard Probes page, all of the Accession values appear in pipe-separated format in the search term box in Search Type.